Top » Catalog » SNPs » A10530

$18.00

A10530
[A10530]

A10530
HG19 Position: ChrY:7021243..7021243
Ancestral: G
Derived: A
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10530_F ATGCACTCTGGGGTTACTGG
Reverse Primer: A10530_R ACCCCTCCCATTCTTTTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies