Top » Catalog » SNPs » A10532

$18.00

A10532
[A10532]

A10532
hg38 Position: ChrY:8432392..8432392
Ancestral: A
Derived: G
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10532_F CAATGCCTTCCCAACACAG
Reverse Primer: A10532_R CTGAGCCTGTGTCTTAAGTAATGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies