Top » Catalog » SNPs » A10534

$18.00

A10534
[A10534]

A10534
HG19 Position: ChrY:16212945..16212945
Ancestral: A
Derived: T
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10534_F CCTCAACCATTCTCTGTCCC
Reverse Primer: A10534_R GGCTCTCAGGCTAATCTGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies