Top » Catalog » SNPs » A10535

$18.00

A10535
[A10535]

A10535
hg38 Position: ChrY:15079816..15079816
Ancestral: A
Derived: G
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10535_F CCAGCCTGGCTTGAAAAAC
Reverse Primer: A10535_R GAGGAGGGGTCTTGTTCTGTC
Reviews

Customers who bought this product also purchased
S7814
S7814
FGC19831
FGC19831
FGC10138
FGC10138
S588
S588
S7050
S7050
A16089
A16089
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies