Top » Catalog » SNPs » A10535

$18.00

A10535
[A10535]

A10535
HG19 Position: ChrY:15079816..15079816
Ancestral: A
Derived: G
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10535_F CCAGCCTGGCTTGAAAAAC
Reverse Primer: A10535_R GAGGAGGGGTCTTGTTCTGTC
Reviews

Customers who bought this product also purchased
S603
S603
BY13680
BY13680
S7814
S7814
FGC19831
FGC19831
FGC10138
FGC10138
S588
S588
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10145
1 x A11498
1 x A11679
1 x A11508
$72.00
Haplogroup Info
Other products
Currencies