Top » Catalog » SNPs » A10536

$16.00

A10536
[A10536]

A10536
HG19 Position: ChrY:17239000..17239000
Ancestral: T
Derived: C
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10536_F GGCAAATAGTAATTTCCTCTTGGG
Reverse Primer: A10536_R TCTTTACACTTGAGAAACTATGTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies