Top » Catalog » SNPs » A10536

$18.00

A10536
[A10536]

A10536
HG19 Position: ChrY:15127120..15127120
Ancestral: T
Derived: C
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10536_F GGCAAATAGTAATTTCCTCTTGGG
Reverse Primer: A10536_R TCTTTACACTTGAGAAACTATGTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1039
1 x A10253
1 x A10293
1 x A11403
1 x A10125
$90.00
Haplogroup Info
Other products
Currencies