Top » Catalog » SNPs » A10538

$18.00

A10538
[A10538]

A10538
HG19 Position: ChrY:17338936..17338936
Ancestral: ins
Derived: del
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10538_F GTTCTGGAGGTTAGAAGTCTGAAATC
Reverse Primer: A10538_R GGAACAAAATGCCTCACCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies