Top » Catalog » SNPs » A10540

$18.00

A10540
[A10540]

A10540
HG19 Position: ChrY:21694491..21694491
Ancestral: A
Derived: C
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10540_F CCCAAGATCAGACAAGGACAC
Reverse Primer: A10540_R GGCTTGTAGCTTTTCACCATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies