Top » Catalog » SNPs » A10541

$17.50

A10541
[A10541]

A10541
HG19 Position: ChrY:22627605..22627605
Ancestral: C
Derived: T
Reference: James Devlin (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of S588 > FGC30690
Forward Primer: A10541_F GGCTGTGGATACACACACCC
Reverse Primer: A10541_R GTAATCACCAAACTTCACACTCCTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies