Top » Catalog » SNPs » A10543

$18.00

A10543
[A10543]

A10543
HG19 Position: ChrY:2980426..2980426
Ancestral: A
Derived: G
Reference: Larry Paroubek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L48
Forward Primer: A10543_F TCAATACGCTGTCCTGAATCC
Reverse Primer: A10543_R AGGGAAGTACATTTTGTCTGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11633
1 x A10117
1 x A11185
1 x A10541
1 x A10633
$90.00
Haplogroup Info
Other products
Currencies