Top » Catalog » SNPs » A10546

$18.00

A10546
[A10546]

A10546
HG19 Position: ChrY:8362932..8362932
Ancestral: T
Derived: C
Reference: Larry Paroubek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L48
Forward Primer: A10546_F CAACTGGTTGCTGGTCTCTG
Reverse Primer: A10546_R CCCAGCACCTTAGTGGAGTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11027
1 x A1165
1 x A10092
$54.00
Haplogroup Info
Other products
Currencies