Top » Catalog » SNPs » A10547

$18.00

A10547
[A10547]

A10547
hg38 Position: ChrY:8647685..8647685
Ancestral: C
Derived: G
Reference: Larry Paroubek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L48
Forward Primer: A10547_F GGAAATGGCACCAGTTATGG
Reverse Primer: A10547_R CTTGGTTGCCATCTAGAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies