Top » Catalog » SNPs » A10549

$18.00

A10549
[A10549]

A10549
hg38 Position: ChrY:11887712..11887712
Ancestral: G
Derived: T
Reference: Larry Paroubek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L48
Forward Primer: A10549_F ATTCAGTCTGGAATGGTTGGAC
Reverse Primer: A10549_R TAGCCCTGCAAAGCTGTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies