Top » Catalog » SNPs » A10550

$18.00

A10550
[A10550]

A10550
HG19 Position: ChrY:12118358..12118358
Ancestral: A
Derived: G
Reference: Larry Paroubek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L48
Forward Primer: A10550_F ATAACTTACATTGTACCCATCAAGAGC
Reverse Primer: A10550_R GCATATTCACAATAGCAAAGACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10652
1 x A11296
1 x A10247
$54.00
Haplogroup Info
Other products
Currencies