Top » Catalog » SNPs » A10553

$18.00

A10553
[A10553]

A10553
HG19 Position: ChrY:16600755..16600755
Ancestral: G
Derived: T
Reference: Larry Paroubek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L48
Forward Primer: A10553_F CAAAAATATACAGGTCAATGGGAG
Reverse Primer: A10553_R ACGGAGTCTCGCTCTGTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies