Top » Catalog » SNPs » A10554

$18.00

A10554
[A10554]

A10554
HG19 Position: ChrY:21256550..21256550
Ancestral: G
Derived: C
Reference: Larry Paroubek (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of L48
Forward Primer: A10554_F TATATGCATGCTGGCCTTTG
Reverse Primer: A10554_R TGGAGATGGAGGGTATTAATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10135
$18.00
Haplogroup Info
Other products
Currencies