Top » Catalog » SNPs » A10556

$18.00

A10556
[A10556]

A10556
HG19 Position: ChrY:8228746..8228746
Ancestral: T
Derived: C
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10556_F CAGAAAGATGTATGGGAACAGG
Reverse Primer: A10556_R GTTGAAGAGAGACTTCCATGAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10324
1 x A11380
1 x A11018
1 x A11118
1 x A1001
$90.00
Haplogroup Info
Other products
Currencies