Top » Catalog » SNPs » A10559

$18.00

A10559
[A10559]

A10559
HG19 Position: ChrY:6982362..6982362
Ancestral: G
Derived: C
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10559_F TGGCTCATGCCTGTAGTGTC
Reverse Primer: A10559_R TGCAGGTGAAGCAAAAAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11547
1 x A11213
1 x A1071
$54.00
Haplogroup Info
Other products
Currencies