Top » Catalog » SNPs » A10561

$17.50

A10561
[A10561]

A10561
HG19 Position: ChrY:8095038..8095038
Ancestral: G
Derived: A
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10561_F CTATTTCTTTAGAGGCATTTAAAGAGTATATAAG
Reverse Primer: A10561_R CTCTTTCAACGGAGGGTATGTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies