Top » Catalog » SNPs » A10562

$18.00

A10562
[A10562]

A10562
HG19 Position: ChrY:8550831..8550831
Ancestral: C
Derived: T
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10562_F CAGCCAGGGATTTCAGAGAG
Reverse Primer: A10562_R CAAACCTGAAAACCCAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies