Top » Catalog » SNPs » A10565

$18.00

A10565
[A10565]

A10565
HG19 Position: ChrY:11976642..11976642
Ancestral: G
Derived: A
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10565_F AAGCACCAGGTTTGGTTAGG
Reverse Primer: A10565_R TCATCTGGGGTTTTGCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10680
1 x A11682
1 x A10982
1 x A10987
1 x A10943
1 x A11195
1 x A11502
1 x A11232
$144.00
Haplogroup Info
Other products
Currencies