Top » Catalog » SNPs » A10565

$18.00

A10565
[A10565]

A10565
HG19 Position: ChrY:14097348..14097348
Ancestral: G
Derived: A
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10565_F AAGCACCAGGTTTGGTTAGG
Reverse Primer: A10565_R TCATCTGGGGTTTTGCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies