Top » Catalog » SNPs » A10566

$18.00

A10566
[A10566]

A10566
HG19 Position: ChrY:12955515..12955515
Ancestral: G
Derived: C
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10566_F TAAAGTGCCCCATGAGAAGG
Reverse Primer: A10566_R ATGGGTGAACTGGGTCTACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies