Top » Catalog » SNPs » A10566

$18.00

A10566
[A10566]

A10566
HG19 Position: ChrY:12955515..12955515
Ancestral: G
Derived: C
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10566_F TAAAGTGCCCCATGAGAAGG
Reverse Primer: A10566_R ATGGGTGAACTGGGTCTACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10639
1 x A10755
1 x A1158
1 x A11512
1 x A10685
1 x A10930
1 x A10312
1 x A11653
1 x A11396
1 x A10151
1 x A11081
1 x A11414
$216.00
Haplogroup Info
Other products
Currencies