Top » Catalog » SNPs » A10567

$18.00

A10567
[A10567]

A10567
hg38 Position: ChrY:13329816..13329816
Ancestral: A
Derived: C
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10567_F TGCACACATCTGGTAATCTGC
Reverse Primer: A10567_R GCAAAGCCTGGAATATCCTATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies