Top » Catalog » SNPs » A10567

$18.00

A10567
[A10567]

A10567
HG19 Position: ChrY:13329816..13329816
Ancestral: A
Derived: C
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10567_F TGCACACATCTGGTAATCTGC
Reverse Primer: A10567_R GCAAAGCCTGGAATATCCTATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11099
1 x A11018
1 x A10821
1 x A10589
1 x A10145
1 x A11532
1 x A10424
$126.00
Haplogroup Info
Other products
Currencies