Top » Catalog » SNPs » A10568

$18.00

A10568
[A10568]

A10568
HG19 Position: ChrY:15753804..15753804
Ancestral: A
Derived: G
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10568_F CATGCCCAGACTAATGCTCAG
Reverse Primer: A10568_R CAAAGGTAAGGATTGCTGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies