Top » Catalog » SNPs » A10569

$17.50

A10569
[A10569]

A10569
HG19 Position: ChrY:17281862..17281862
Ancestral: ins
Derived: del
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10569_F ATTGAGCCACCATGCCG
Reverse Primer: A10569_R ATATATCTATCTCTACTATGTCTACCATTTATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies