Top » Catalog » SNPs » A10570

$18.00

A10570
[A10570]

A10570
HG19 Position: ChrY:15173837..15173837
Ancestral: C
Derived: T
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10570_F TCTGAACATTGAAATTTTGTTTGAC
Reverse Primer: A10570_R GAATTCACCCCCAAATTTATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11219
1 x A10880
1 x A11391
1 x A10159
1 x A11462
1 x A11099
$108.00
Haplogroup Info
Other products
Currencies