Top » Catalog » SNPs » A10571

$18.00

A10571
[A10571]

A10571
HG19 Position: ChrY:17169600..17169600
Ancestral: ins
Derived: del
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10571_F TAAAATGCACTGAAGGGCAAG
Reverse Primer: A10571_R CCTTTCTTACTAAAAGCCTCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10103
1 x A11123
1 x A11003
1 x A10589
1 x A10145
1 x A10316
1 x A11615
1 x A10517
1 x A11286
$162.00
Haplogroup Info
Other products
Currencies