Top » Catalog » SNPs » A10571

$18.00

A10571
[A10571]

A10571
HG19 Position: ChrY:19281480..19281480
Ancestral: ins
Derived: del
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10571_F TAAAATGCACTGAAGGGCAAG
Reverse Primer: A10571_R CCTTTCTTACTAAAAGCCTCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies