Top » Catalog » SNPs » A10573

$18.00

A10573
[A10573]

A10573
HG19 Position: ChrY:17179495..17179495
Ancestral: A
Derived: G
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10573_F ATAGCAAATGCATAAACCATTAACAC
Reverse Primer: A10573_R CTCCTGCCATAGGTAAGAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10847
1 x A1010
$36.00
Haplogroup Info
Other products
Currencies