Top » Catalog » SNPs » A10574

$18.00

A10574
[A10574]

A10574
hg38 Position: ChrY:17370127..17370127
Ancestral: A
Derived: G
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10574_F GGGATTATGGCATGTTTGTG
Reverse Primer: A10574_R ATTTTCTACCTTCAGCCAGATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies