Top » Catalog » SNPs » A10574

$17.50

A10574
[A10574]

A10574
HG19 Position: ChrY:19482007..19482007
Ancestral: A
Derived: G
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10574_F GGGATTATGGCATGTTTGTG
Reverse Primer: A10574_R ATTTTCTACCTTCAGCCAGATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies