Top » Catalog » SNPs » A10575

$17.50

A10575
[A10575]

A10575
HG19 Position: ChrY:21441868..21441868
Ancestral: A
Derived: G
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10575_F CTTTAACACCAATTGACTGTCCAAC
Reverse Primer: A10575_R GGAAGGGTGTTTCTTTGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies