Top » Catalog » SNPs » A10575

$18.00

A10575
[A10575]

A10575
hg38 Position: ChrY:19279982..19279982
Ancestral: A
Derived: G
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10575_F CTTTAACACCAATTGACTGTCCAAC
Reverse Primer: A10575_R GGAAGGGTGTTTCTTTGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies