Top » Catalog » SNPs » A10580

$18.00

A10580
[A10580]

A10580
HG19 Position: ChrY:21394628..21394628
Ancestral: A
Derived: C
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10580_F ACGTTTTATGGTGAGGCAGAC
Reverse Primer: A10580_R CATATTACTAAAAGAAGCATATGGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1097
1 x A10917
1 x A11502
1 x A10718
$72.00
Haplogroup Info
Other products
Currencies