Top » Catalog » SNPs » A10582

$18.00

A10582
[A10582]

A10582
hg38 Position: ChrY:22328112..22328112
Ancestral: G
Derived: A
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10582_F CTCTGAGGCCAAAAGTCTGAG
Reverse Primer: A10582_R TGTCATCAAATCACATACTACTAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies