Top » Catalog » SNPs » A10589

$18.00

A10589
[A10589]

A10589
HG19 Position: ChrY:17233870..17233870
Ancestral: T
Derived: A
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10589_F ATCCCAGTCTTGCCAAGCTAC
Reverse Primer: A10589_R CTTGCAGAATTCAATTTTGTTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10624
1 x A10937
1 x A10685
1 x A10938
$72.00
Haplogroup Info
Other products
Currencies