Top » Catalog » SNPs » A10560

$18.00

A10560
[A10560]

A10560
HG19 Position: ChrY:7003527..7003527
Ancestral: G
Derived: T
Reference: Ray Rolla McCall (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10560_F GGCATGTGACTGTGGAGATG
Reverse Primer: A10560_R GTCTCTGGATGGCAAGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10510
1 x A10253
1 x A10618
1 x A11529
$72.00
Haplogroup Info
Other products
Currencies