Top » Catalog » SNPs » A10594

$17.50

A10594
[A10594]

A10594
HG19 Position: ChrY:8884363..8884363
Ancestral: C
Derived: T
Reference: Iain McDonald (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream U106 > Z156 > S8350
Forward Primer: A10594_F CCTAGGATCATGGAAATATGCTG
Reverse Primer: A10594_R GGTATCAACCTCATCTGCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies