Top » Catalog » SNPs » A10594

$18.00

A10594
[A10594]

A10594
HG19 Position: ChrY:9016322..9016322
Ancestral: C
Derived: T
Reference: Iain McDonald (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream U106 > Z156 > S8350
Forward Primer: A10594_F CCTAGGATCATGGAAATATGCTG
Reverse Primer: A10594_R GGTATCAACCTCATCTGCTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10996
$18.00
Haplogroup Info
Other products
Currencies