Top » Catalog » SNPs » A10629

$18.00

A10629
[A10629]

A10629
HG19 Position: ChrY:21849925..21849925
Ancestral: G
Derived: A
Reference: Jim Graham (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream M222 > DF104 > FGC4108/S588
Forward Primer: A10629_F CTTTTCAGCTGGAGAAATAATTATTG
Reverse Primer: A10629_R CCTTCTCCACTTGCTCTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies