Top » Catalog » SNPs » A10630

$18.00

A10630
[A10630]

A10630
HG19 Position: ChrY:22219971..22219971
Ancestral: A
Derived: G
Reference: Jim Graham (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream M222 > DF104 > FGC4108/S588
Forward Primer: A10630_F TAAAGTAAAAGGGCCAGAACGAG
Reverse Primer: A10630_R TTCTTTGTTCCTTGTCCTAAATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies