Top » Catalog » SNPs » A10634

$18.00

A10634
[A10634]

A10634
HG19 Position: ChrY:11942397..11942397
Ancestral: A
Derived: G
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255 > Z16438 > A5631
Forward Primer: A10634_F GATCTCTCTAGCCCAGGAGTTG
Reverse Primer: A10634_R TGGTGCCCATGATCTGTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10299
$18.00
Haplogroup Info
Other products
Currencies