Top » Catalog » SNPs » A10647

$18.00

A10647
[A10647]

A10647
HG19 Position: ChrY:13208999..13208999
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10647_F CCTTTCCTGTCTGGCCTG
Reverse Primer: A10647_R GAAGTCCTGAGAACATCATCACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies