Top » Catalog » SNPs » A10522

$18.00

A10522
[A10522]

A10522
HG19 Position: ChrY:19227550..19227550
Ancestral: T
Derived: C
Reference: James Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10522v2_F ATTGCTGGTTGCTAGAGACTGAG
Reverse Primer: A10522v2_R TCCTGGAAAACTCATGAATAATATAGG
Reviews

Customers who bought this product also purchased
A10523
A10523
A10521
A10521
A10520
A10520
A10519
A10519
A10518
A10518
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11738
$18.00
Haplogroup Info
Other products
Currencies