Top » Catalog » SNPs » A10650

$18.00

A10650
[A10650]

A10650
HG19 Position: ChrY:20052196..20052196
Ancestral: A
Derived: T
Reference: Peter Plant (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream L617
Forward Primer: A10650_F TGTCCAATGGTCATCACAGTC
Reverse Primer: A10650_R TGCTTGCCAGTAGCTTTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11697
1 x A11653
1 x A11007
1 x A10537
1 x A10244
1 x A1053
$108.00
Haplogroup Info
Other products
Currencies