Top » Catalog » SNPs » A10652

$17.50

A10652
[A10652]

A10652
HG19 Position: ChrY:15867423..15867423
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10652_F TACCACCTCCTGAAATGTCG
Reverse Primer: A10652_R TGAAACATACCAGCCAGGTTAG
Reviews

Customers who bought this product also purchased
A10653
A10653
A10654
A10654
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies