Top » Catalog » SNPs » A10652

$18.00

A10652
[A10652]

A10652
HG19 Position: ChrY:15867423..15867423
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10652_F TACCACCTCCTGAAATGTCG
Reverse Primer: A10652_R TGAAACATACCAGCCAGGTTAG
Reviews

Customers who bought this product also purchased
S744
S744
FGC32580
FGC32580
A9880
A9880
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
FGC32575
FGC32575
A9012
A9012
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies