Top » Catalog » SNPs » A10652

$18.00

A10652
[A10652]

A10652
HG19 Position: ChrY:13755543..13755543
Ancestral: T
Derived: C
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10652vl_F TACCACCTCCTGAAATGTCG
Reverse Primer: A10652vl_R AAATATGGAGCCCAGGGTAAG
Reviews

Customers who bought this product also purchased
S695
S695
A9019
A9019
S691
S691
A6091
A6091
S764
S764
A10738
A10738
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies